View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7797_low_2 (Length: 321)
Name: NF7797_low_2
Description: NF7797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7797_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 59 - 203
Target Start/End: Original strand, 40429942 - 40430086
Alignment:
| Q |
59 |
caaagtgagttaaaaatggctgaagaggattcggttgaaatcaggtttaggttaaacaatggttctgatattggatcgtttaagtattcttctgctgcca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40429942 |
caaagtgagttaaaaatggctgaagaggattcggttgaaatcaggtttaggttaaacaatggttctgatattggaccgtttaagtattcttctgctgcca |
40430041 |
T |
 |
| Q |
159 |
ctgttgatatgcttaagcaaaggattatctctcattggcctcaag |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40430042 |
ctgttgatatgcttaagcaaaggattatctctcattggcctcaag |
40430086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 80 - 199
Target Start/End: Original strand, 40424420 - 40424539
Alignment:
| Q |
80 |
gaagaggattcggttgaaatcaggtttaggttaaacaatggttctgatattggatcgtttaagtattcttctgctgccactgttgatatgcttaagcaaa |
179 |
Q |
| |
|
||||| |||| |||||| |||| |||||||||| || ||||||||||||||||| |||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
40424420 |
gaagaagatttggttgatatcaagtttaggttatacgatggttctgatattggaccgtttaggtattcatctgctgctactgttgatatgcttaagcaaa |
40424519 |
T |
 |
| Q |
180 |
ggattatctctcattggcct |
199 |
Q |
| |
|
| ||| ||||| |||||||| |
|
|
| T |
40424520 |
gaattgtctctgattggcct |
40424539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University