View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7798_low_14 (Length: 333)
Name: NF7798_low_14
Description: NF7798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7798_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 11 - 319
Target Start/End: Original strand, 41325537 - 41325846
Alignment:
| Q |
11 |
cagagacaatg-aatgacaaacattggctactatctttgattttatctgccctctcttcggaagtggtcttgatcttgagcatctgaacctgcagttcaa |
109 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41325537 |
cagagacaatggaatgacaaacattggctactatctttgattttatctgccctctcttcggaagtggtcttgatcttgagcatctgaacctgcagttcaa |
41325636 |
T |
 |
| Q |
110 |
gtttgcaatttctgaagattcaaaatgatggacagtagtggtattcattttgctaaataaatgaataattgatgcttggtttatacctttagcaggagca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41325637 |
gtttgcaatttctgaagattcaaaatgatggacagtagtggtattcattttgctaaataaatgaataattgatgcttggtttatacctttagcaggagca |
41325736 |
T |
 |
| Q |
210 |
tgaggtctatgagtttatatagatgacttgattaccatacaattggaataccgggtgtaagccctgtgggctaaactgaaagcagatttacaagtaaaca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41325737 |
tgaggtctatgagtttatatagatgacttgattaccatacaatttgaataccgggtgtaagccctgtgggctaaactgaaagcagatttacaagtaaaca |
41325836 |
T |
 |
| Q |
310 |
agtattaatt |
319 |
Q |
| |
|
|||||||||| |
|
|
| T |
41325837 |
agtattaatt |
41325846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University