View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7798_low_18 (Length: 292)
Name: NF7798_low_18
Description: NF7798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7798_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 111 - 273
Target Start/End: Original strand, 40675868 - 40676034
Alignment:
| Q |
111 |
tcccggtaatttgtttactttctgatgcattttacaagtgatcttgctgctaatctctct----ggtgtagaagcattacttacacactggtatcctgaa |
206 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
40675868 |
tcccggtaatttgtctactttctgatgcattttacaagtgatcctgccgctaatctctctagtacgtgtagaagcattacttacacactagtatcctgaa |
40675967 |
T |
|
| Q |
207 |
tttaagatgtttctgtaagatagtgtcatggctacctggccaaaagtcaaggaattggccgagacaa |
273 |
Q |
| |
|
||| |||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40675968 |
tttgagatgtttctgttagatagtgtcatagctacctggccaaaagtcaaggaattggccgagacaa |
40676034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 40675836 - 40675869
Alignment:
| Q |
1 |
aacagattgcaagcaaatagtggactccgatatc |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40675836 |
aacagattgcaagcaaatagtggactccgatatc |
40675869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University