View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7798_low_18 (Length: 292)

Name: NF7798_low_18
Description: NF7798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7798_low_18
NF7798_low_18
[»] chr5 (2 HSPs)
chr5 (111-273)||(40675868-40676034)
chr5 (1-34)||(40675836-40675869)


Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 111 - 273
Target Start/End: Original strand, 40675868 - 40676034
Alignment:
111 tcccggtaatttgtttactttctgatgcattttacaagtgatcttgctgctaatctctct----ggtgtagaagcattacttacacactggtatcctgaa 206  Q
    |||||||||||||| |||||||||||||||||||||||||||| ||| ||||||||||||     |||||||||||||||||||||||| ||||||||||    
40675868 tcccggtaatttgtctactttctgatgcattttacaagtgatcctgccgctaatctctctagtacgtgtagaagcattacttacacactagtatcctgaa 40675967  T
207 tttaagatgtttctgtaagatagtgtcatggctacctggccaaaagtcaaggaattggccgagacaa 273  Q
    ||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||    
40675968 tttgagatgtttctgttagatagtgtcatagctacctggccaaaagtcaaggaattggccgagacaa 40676034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 40675836 - 40675869
Alignment:
1 aacagattgcaagcaaatagtggactccgatatc 34  Q
    ||||||||||||||||||||||||||||||||||    
40675836 aacagattgcaagcaaatagtggactccgatatc 40675869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University