View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7798_low_19 (Length: 283)
Name: NF7798_low_19
Description: NF7798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7798_low_19 |
 |  |
|
| [»] scaffold0485 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0485 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: scaffold0485
Description:
Target: scaffold0485; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 123 - 267
Target Start/End: Original strand, 7753 - 7897
Alignment:
| Q |
123 |
agaattctaatcatactatatttcttcccaagggtaaaaaatattctttcttcccctcaatatataaaaaacattctttctttttcttttactattaaag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7753 |
agaattctaatcatactatatttcttcccaagggtaaaaaatattctttcttcccctcaaaatataaaaaacattctttctttttcttttactattaaag |
7852 |
T |
 |
| Q |
223 |
ggtaaaaaataatcgaatacatctattttatatgataaatatatt |
267 |
Q |
| |
|
| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7853 |
gctaaaaaataattaaatacatctattttatatgataaatatatt |
7897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University