View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7798_low_20 (Length: 257)
Name: NF7798_low_20
Description: NF7798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7798_low_20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 13 - 257
Target Start/End: Original strand, 24377002 - 24377249
Alignment:
| Q |
13 |
agtgagaagaaacaaaaaagcacggaataatcggcggcaatggctaaacaacctttgaaagttgagtatataacatc---ccaactcagtcggatttaga |
109 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |||||||||||||||||||| |
|
|
| T |
24377002 |
agtgaaaataaacagaaaagcacggaataatcggcggcaatggctaaacaacctttgaaagtggagtatataacaacaacccaactcagtcggatttaga |
24377101 |
T |
|
| Q |
110 |
atctccacactcggtgcgggatccttacccggttcagtac-----ttcaggtacccactccacccacctcttctcaatttaatttactttattaggcggt |
204 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24377102 |
atctccacactcggtgcgg-atccttacccggttcagtaaagtagttcaggtccccactccacccacctcttctcaatttaatttactttattaggcggt |
24377200 |
T |
|
| Q |
205 |
tacaattctttttagtcggttatttatggtttttatatgtccgcgttactatt |
257 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| |||||| |||| |
|
|
| T |
24377201 |
tacaattctttttagtcgg----ttatgttttttatatgtcagcgttagtatt |
24377249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University