View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7798_low_24 (Length: 215)
Name: NF7798_low_24
Description: NF7798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7798_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 18 - 73
Target Start/End: Original strand, 32325417 - 32325473
Alignment:
| Q |
18 |
atagggtactcatctgaaaatgtattagtt-gaaaggaagctcagtaagaacaatgg |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32325417 |
atagggtactcatctgaaaatgtattagttggaaaggaagctcagtaagaacaatgg |
32325473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University