View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7799_low_20 (Length: 285)
Name: NF7799_low_20
Description: NF7799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7799_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 269
Target Start/End: Complemental strand, 51933265 - 51933015
Alignment:
| Q |
19 |
caatctaccccccaattcattttctctttacaaccagaaacccaccaacaaactcttcaattcgaggacccttttctcaaaccccatcttctcaacaaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51933265 |
caatctaccccccaattcattttctctttacaaccagaaacccaccaacaaactcttcaattcgaggacccttttctcaaaccccatcttctcaacaaga |
51933166 |
T |
|
| Q |
119 |
gttcaagcactcaaatctgatggtgctggttggaagaaaagaggtaaagaatcatacagtgacagtgatgatagcgactatgaagatgacacaccaaaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51933165 |
gttcaagcactcaaatctgatggtgctggttggaagaaaagaggtaaagaatcatacagtgacagtgatgatagcgactatgaagatgacacaccaaaag |
51933066 |
T |
|
| Q |
219 |
aaaatgacccttatgttatgactcttgaagagagacaagaatggagaagaa |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51933065 |
aaaatgacccttatgttatgactcttgaagagagacaagaatggagaagaa |
51933015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University