View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7800_high_21 (Length: 294)
Name: NF7800_high_21
Description: NF7800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7800_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 32713037 - 32712761
Alignment:
| Q |
1 |
tgttcatcatcagaaggttttatatgttactaagagcttcagatttgaactttctttttccaagttactggttgtatgtctacggaatacagtccatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32713037 |
tgttcatcatcagaaggttttatatgttactaagagcttcagatttgaactttctttttccaagttactggttgtatgtctacggactacagtccatgat |
32712938 |
T |
|
| Q |
101 |
tatgtttttgttggatcttattgtctttccttgtccccaaaccatggatatctgttaaattaaatcccccattgcgctctctctcacttaatccataaag |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32712937 |
catgtttttgttgtatcttattgtctttccttgtccccaaaccatggatatctgttaaattaaatcccccattgcgctctctctcacttaatccttaaag |
32712838 |
T |
|
| Q |
201 |
tagtatataaaaagaaattcgcaaattagactctattgttatacatttacaaacaatatataatattattttgatat |
277 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32712837 |
tagtatataaacagaaattcgcaaattagagtctattgttatacatttacgaacaatatataatattattttgatat |
32712761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 93 - 133
Target Start/End: Complemental strand, 12233869 - 12233829
Alignment:
| Q |
93 |
tccatgattatgtttttgttggatcttattgtctttccttg |
133 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
12233869 |
tccatgatcatgtttttgttggatcttattgtcttttcttg |
12233829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University