View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7800_high_22 (Length: 287)
Name: NF7800_high_22
Description: NF7800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7800_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 16 - 269
Target Start/End: Complemental strand, 47192581 - 47192328
Alignment:
| Q |
16 |
ctccacaaataccatgaacctcacatggttcagcaatagcttgccatgaaacttcccatgtcttagttttatcactgaagctataaacacgtgggttacc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47192581 |
ctccacaaataccatgaacctcacatggttcagcaatagcttgccatgaaacttcccatgtcttagttttatcattgaagctataaacacgtgggttacc |
47192482 |
T |
 |
| Q |
116 |
atcatgatccattttgagtaatctatgaagtttctttggataatcaatggtgaaaaattggtatgcatcagaggacatgaaatggccaaaggaatcgagt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47192481 |
atcatgatccattttgagtaatctatgaagtttctttggataatcaatggtgacaaattggtatgcatcagaggacatgaaatggccaaaggaatcgagt |
47192382 |
T |
 |
| Q |
216 |
agcgcgattttagtaacattataagttgatcttcctgcatcaacaggtaatacc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47192381 |
agcgcgattttagtaacattataagttgatcttcctgcatcaacaggtaatacc |
47192328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University