View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7800_high_24 (Length: 274)
Name: NF7800_high_24
Description: NF7800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7800_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 40 - 260
Target Start/End: Complemental strand, 36678304 - 36678084
Alignment:
| Q |
40 |
ggtaaggttattaatataaaattgactttatcaaatcaaattatcattgcacttttaatgtcctatgatggcgggggaagtgggaaagtactttcgcaaa |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36678304 |
ggtaaggttattaatataaaattgactttatcaaatcaaatta-cattgcacttttaatgtcctatgatggcgggggaagtgggaaagtactttcgcaaa |
36678206 |
T |
|
| Q |
140 |
aggtcctatagaacttttgaataggatttaattaagtatattagcattttcctcaagtatttgacagagtgtatgccata-ggggnnnnnnnnnggtagg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
36678205 |
aggtcctatagaacttttgaataggatttaattaagtatattagcattttcctcaagtatttgacagagtgtatgccatagggggaaaaaaaaaggtagg |
36678106 |
T |
|
| Q |
239 |
gacacacaagctgggaaatatg |
260 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36678105 |
gacacacaagctgggaaatatg |
36678084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University