View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7800_low_10 (Length: 378)
Name: NF7800_low_10
Description: NF7800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7800_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 8 - 361
Target Start/End: Complemental strand, 39695271 - 39694918
Alignment:
| Q |
8 |
agaagaacaagaagaagcacggtgctccagcaccatcaccagcgttgttgggtccaccagcaccaccagcaggagcacctggaccaagcgaagatgcgtc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39695271 |
agaagaacaagaagaagcacggtgctccagcaccatcaccagcgttgttgggtccaccagcaccaccagcaggagcacctggaccaagcgaagatgcgtc |
39695172 |
T |
|
| Q |
108 |
ttcacctggacccgctactaccgcgaacgatgaggtaaatcttgtttttgtcttttctttgtcgtttctatatttaacatagtacaatgtggttcagatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39695171 |
ttcacctggacccgctactaccgcgaacgatgaggtaaatcttgtttttgtcttttctttgtcgtttctatatttaacatagtacaatgtggttcagatc |
39695072 |
T |
|
| Q |
208 |
tgttacatacacacacttgttttcactttgtgnnnnnnnctaaccaaaatctaagaacaaacggtaacttgaactcaaaaatctaagtttaaggtattcc |
307 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39695071 |
tgttacatacatacacttgttttcactttgtgtttttttctaaccaaaatctaagaacaaacggtaacttgaactcaaaaatctaagtttaaggtattcc |
39694972 |
T |
|
| Q |
308 |
acgcgccaccattgacggtgggtttggtaggacacaccttattaggtctgaatt |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39694971 |
acgcgccaccattgacggtgggtttggtaggacacaccttattaggtctgaatt |
39694918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University