View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7800_low_31 (Length: 247)
Name: NF7800_low_31
Description: NF7800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7800_low_31 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 247
Target Start/End: Original strand, 30418449 - 30418685
Alignment:
| Q |
15 |
cacacacgccaccttatctggaactttccgactgaggtaccagaaaattcaaaatcagaccgtttttctagatcctggcactcc----ttccgttgccct |
110 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
30418449 |
cacacacgccaccttatttggaactttccgactgaggtaccagaaatttcaaaatcaaaccgtttttctagatcctagcactccctccttccgttgccct |
30418548 |
T |
|
| Q |
111 |
tttcaaccacccacgagtcaaaatcgattcgctttaccactagatgccgatgaagagtggtcctccttaccaaagatgtgatgatattgattctcgccac |
210 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30418549 |
tttcaaccacccacgagtcaaaattgatccgctttaccactagatgccgatgaagagtggtcctccttaccaaagatgtgatgatattgattctcgccac |
30418648 |
T |
|
| Q |
211 |
catcacactattcccagccaccgtttcttcatcaaaa |
247 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30418649 |
catcacactatttccagccaccgtctcttcatcaaaa |
30418685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University