View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7801_high_10 (Length: 252)
Name: NF7801_high_10
Description: NF7801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7801_high_10 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 252
Target Start/End: Original strand, 37863614 - 37863855
Alignment:
| Q |
9 |
tttggtgttgttgctcggtgtgggtgtgggtgaagaaagaataagactgattacaattttcagaatttactcgctattgttgtgagnnnnnnnnnaataa |
108 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37863614 |
tttgttgttgttgctcggtg--ggtgtgggtgaagaaagaataagactaattacaattttcagaatttactcgctattgttgtgagtttttttttaataa |
37863711 |
T |
 |
| Q |
109 |
taatttatgttgacgttgtgatacttgcaaggtgcaacaactctgaagcgaaactccatgtcacaaacgatggaaaatggaaatagggaagaaaagaaat |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37863712 |
taatttatgttgacgttgtgattcttgcaaggtgcaacaactctgaagcgaaactccatgtcacaaacgatggaaaatggaaatagggaagaaaagaaat |
37863811 |
T |
 |
| Q |
209 |
taacagaataataattgtgttaagggatgtgtttgtctattata |
252 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37863812 |
taacagaataataatggtgttaagggatgtgtttgtctattata |
37863855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University