View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7801_low_17 (Length: 240)
Name: NF7801_low_17
Description: NF7801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7801_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 150 - 222
Target Start/End: Complemental strand, 37816045 - 37815973
Alignment:
| Q |
150 |
gaggagttgtgctcataaaggatgaagtaagatagggtttggatcttatctgcaactacaacacatactgcac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37816045 |
gaggagttgtgctcataaaggatgaagtaagatagggtgtggatcttatctgcaactacaacacatactgcac |
37815973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University