View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7801_low_17 (Length: 240)

Name: NF7801_low_17
Description: NF7801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7801_low_17
NF7801_low_17
[»] chr8 (1 HSPs)
chr8 (150-222)||(37815973-37816045)


Alignment Details
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 150 - 222
Target Start/End: Complemental strand, 37816045 - 37815973
Alignment:
150 gaggagttgtgctcataaaggatgaagtaagatagggtttggatcttatctgcaactacaacacatactgcac 222  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
37816045 gaggagttgtgctcataaaggatgaagtaagatagggtgtggatcttatctgcaactacaacacatactgcac 37815973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University