View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7801_low_22 (Length: 219)
Name: NF7801_low_22
Description: NF7801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7801_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 53880930 - 53880746
Alignment:
| Q |
18 |
tattacgtataggaggcgttctaggtcgccctatctctggtagtgggaccttgtcctagtcgctcatcccgttggggattgttcactttaatttcttttg |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53880930 |
tattatgtataggaggcgttctaggtcgccctatctctggtagtgggaccttgtcctagtcgctcatcccgttggggattgttcactttaatttcttttg |
53880831 |
T |
|
| Q |
118 |
taggttgtcaagtgcttcctagctttgatgtttcgggagatggtggttcgatcaggatccagcagaccgtgattgatgtttttgg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53880830 |
taggttgtcaagtgcttcctagctttgatgtttcgggagatggtggttcgatcaggatccagcagaccgtgattgatgtttttgg |
53880746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 53887044 - 53886860
Alignment:
| Q |
18 |
tattacgtataggaggcgttctaggtcgccctatctctggtagtgggaccttgtcctagtcgctcatcccgttggggattgttcactttaatttcttttg |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53887044 |
tattatgtataggaggcgttctaggtcgccctatctctggtagtgggaccttgtcctagtcgctcatcccgttggggattgttcactttaatttcttttg |
53886945 |
T |
|
| Q |
118 |
taggttgtcaagtgcttcctagctttgatgtttcgggagatggtggttcgatcaggatccagcagaccgtgattgatgtttttgg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53886944 |
taggttgtcaagtgcttcctagctttgatgtttcgggagatggtggttcgatcaggatccagcagaccgtgattgatgtttttgg |
53886860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University