View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7802_high_19 (Length: 368)
Name: NF7802_high_19
Description: NF7802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7802_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 14 - 365
Target Start/End: Complemental strand, 42302460 - 42302110
Alignment:
| Q |
14 |
atgttgcaccccagcaggcaatctagatgttgtcgtgaaggcttataggaatcgaacacaacatatgcaagatctaacgaaggatcatagagctagtgag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42302460 |
atgttgcaccccagcaggcaatctagatgttgttgtgaaggcttataggaagcgaacacaacatatgcaagatctaacgaaggatcatagagctagtgag |
42302361 |
T |
|
| Q |
114 |
gatcatagtaatttagatcaaagtctttgagtctaatcttcactacaatcagggaagcttgtcctgtaaagcaaacaatactaaatcaaatagtgaaatg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42302360 |
gatcatagtaatttagatcaaagtctttgagtctaatcttcactacaatcagggaagcttgtcctgtaaagcaaacaatactagatcaaatagtgaaatg |
42302261 |
T |
|
| Q |
214 |
aatgtctatgtactagttgatctaattgttgtatttgtactggtttatctaaaattgtttgctttagagacagtgcttcattgtccttatagtcaaagat |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
42302260 |
aatgtctatgtactagttgatctaattgttgtatttgtactggttgatctaaaattgtttgctttagagacggtgcttcattgtccttatagtc-aagat |
42302162 |
T |
|
| Q |
314 |
tagactttgaaatactttgatcaaaattgaatataaggatattcttcgacat |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
42302161 |
tagactttgaaatactttgatcaaaattgaatataaggatatttttcaacat |
42302110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University