View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7802_high_30 (Length: 300)
Name: NF7802_high_30
Description: NF7802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7802_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 720047 - 720329
Alignment:
| Q |
1 |
agtttgatgacatgaaaaattcatcaatcttctaagaaacaaaacttaagtttaagaaaacttgcatcatgaaaaacaccaa-atgtcccagcttcatct |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
720047 |
agtttgatgacatgaaaaattcatcaatcttctaagaaacaaaatttaagtttaagaaaacttgcatcatgaaaaacaccaagatgtcccagcttcatct |
720146 |
T |
 |
| Q |
100 |
aaagcaacaaaaccaaagtttaagaaaacatgcatcatggaaaataccaagatgtcccagcttcatacggtggtggtggtggcttgctaaaatattttct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
720147 |
aaagcaacaaaaccaaagtttaagaaaacatgcatcatggaaaataccaagatgtcccagcttcatacggtggtggtggtggcttgctaaaatattttct |
720246 |
T |
 |
| Q |
200 |
gacccaaacatgtttcccattgatgatgaatttcaatcttgggttatactcaagaagataattaattacatccataccctcac |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
720247 |
gacccaaacatgtttcccattgatgatgaatttcaatcttgggttatactcaagaagataattaattacatccataccctcac |
720329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University