View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7802_high_45 (Length: 219)
Name: NF7802_high_45
Description: NF7802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7802_high_45 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 9926846 - 9927064
Alignment:
| Q |
1 |
ggaacaaaataggaaaccagtgtcttttgaaggtagatatttagctgctgatactccctccttcaaatgcagcaggaaggtagccatgtttcctttttca |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9926846 |
ggaacaaaataggataccagtgtcttttgaaggtagatatttagctgctgatactccctccttcaaatgcagcaggaaggtagccatgtttcctttttca |
9926945 |
T |
 |
| Q |
101 |
ttctctttcaattaaaaaatgaaacttgagttgtttatttcttagtgctttaaattatttacattgactcatggtagaaatagaatcacgacaccgagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9926946 |
ttctctttcaattaaaaaatgaaacttgagttgtttatttcttagtgctttaaattatttacattgactcatggtagaaatagaatcacgacaccgagat |
9927045 |
T |
 |
| Q |
201 |
tttggcaaaaactatattc |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
9927046 |
tttggcaaaaactatattc |
9927064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University