View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7802_low_32 (Length: 304)
Name: NF7802_low_32
Description: NF7802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7802_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 8e-64; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 14081538 - 14081669
Alignment:
| Q |
1 |
gaatagtgggggtgctgatagaaattttgggggtgctgaaaggaatagtgggggtggagataggaatttgattcataggtcggatagtttttgtggaggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14081538 |
gaatagtgggggtgctgatagaaattttgggggtgctgaaaggaatagtgggggtggagataggaatttgattcataggtcggagagtttttgtggaggg |
14081637 |
T |
|
| Q |
101 |
tcaaggagagagtttccgaaggggtttcgatc |
132 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |
|
|
| T |
14081638 |
tcaaggagggagtttccgaaggggtttcgatc |
14081669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 185 - 288
Target Start/End: Original strand, 14081722 - 14081822
Alignment:
| Q |
185 |
ttgaaggattttgatgagagtagtagagggagtggtggtgctggtagtagggttgaagagagggtggttaggtctccgaagggtttttcaagggatgtga |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14081722 |
ttgaaggattttgatgagagtagtagagggagtggtggtg---gtagtagggttgaagagagggtggttaggtctccgaagggtttttcgagggatgtga |
14081818 |
T |
|
| Q |
285 |
aatc |
288 |
Q |
| |
|
|||| |
|
|
| T |
14081819 |
aatc |
14081822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 14081496 - 14081564
Alignment:
| Q |
1 |
gaatagtgggggtgctgatagaaattttgggggtgctgaaaggaatagtgggggtggagataggaattt |
69 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
14081496 |
gaatattgggggtgctgatagaaattgtgggggtgctgaaaggaatagtgggggtgctgatagaaattt |
14081564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University