View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7802_low_37 (Length: 290)
Name: NF7802_low_37
Description: NF7802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7802_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 6 - 276
Target Start/End: Original strand, 37641265 - 37641535
Alignment:
| Q |
6 |
tttcgtgttggtttggggataaaatggtaaaagaatggaagcatttgaggacttataggattgagtatgcacaacctaatcagtgtccacctacgaattt |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37641265 |
tttcgggttggtttggggataaaatggtaaaagaatggaagcatttgaggacttataggattgagtatgcacaacctaatcagtgtccacctacgaattt |
37641364 |
T |
 |
| Q |
106 |
gaagaaaaacccaacaattgaaccgggtttgtatttgtgcggtgattatttgacttcagctacatttgacggtgctttggtttctggtaggagagcagct |
205 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37641365 |
gaagaaaaacccaacaattgaacagggtttgtatttgtgcggtgattatttgacttcagctacatttgacggtgctttggtttctggtaggagagcagct |
37641464 |
T |
 |
| Q |
206 |
gaatcactgttaaatgatagagccttctttggctaattgcttcattcatattcttactttacattgtatgt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37641465 |
gaatcactgttaaatgatagagccttctttggctaattgcttcattaatattcttactttacattgtatgt |
37641535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University