View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7803_high_9 (Length: 235)
Name: NF7803_high_9
Description: NF7803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7803_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 6806843 - 6806643
Alignment:
| Q |
17 |
atactcatgcaccttcacaaggaaacatcatcccattgccacaaactgatcatgacacatatggtcctgcagtaaccgtaagaaatgcacgcagattctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6806843 |
atactcatgcaccttcacaaggaaacatcatcccattgccacaaactgatcatgacacatatggtcctgcagtaaccgtaagaaatgcacgcagattctt |
6806744 |
T |
 |
| Q |
117 |
gaagatttctaagcttctgtttgcagatctcatcttgaattttcaagatgtttcagaaagcagatcttctttacttcttggaaatggaaagggagggttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6806743 |
gaagatttctaagcttctgtttgcagatctcatcttgaattttcaagatgtttcagaaagcagatcttctttacttcttggaaatggaaagggagggttt |
6806644 |
T |
 |
| Q |
217 |
g |
217 |
Q |
| |
|
| |
|
|
| T |
6806643 |
g |
6806643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 7329031 - 7328828
Alignment:
| Q |
17 |
atactcatgcaccttcacaaggaaacatca---tcccattgccacaaactgatcatgacacatatggtcctgcagtaaccgtaagaaatgcacgcagatt |
113 |
Q |
| |
|
||||||| |||||||| ||||| |||||| ||||||||||| ||||||||||||||| ||||||||||||| |||| |||||||| |||| || ||| |
|
|
| T |
7329031 |
atactcacgcaccttcgcaaggtgacatcaacatcccattgccagaaactgatcatgacatatatggtcctgcaataactgtaagaaaagcacacaaatt |
7328932 |
T |
 |
| Q |
114 |
cttgaagatttctaagcttctgtttgcagatctcatcttgaattttcaagatgtttcagaaagcagatcttctttacttcttggaaatggaaagggaggg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| || | ||||||||||||| |||| |
|
|
| T |
7328931 |
cttgaagatttctaagcttctgtttgcagatctcatcttgagttttcaagatgtttcggaaagcagatcttctctattgagtggaaatggaaagaaaggg |
7328832 |
T |
 |
| Q |
214 |
tttg |
217 |
Q |
| |
|
|||| |
|
|
| T |
7328831 |
tttg |
7328828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University