View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7803_low_14 (Length: 330)
Name: NF7803_low_14
Description: NF7803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7803_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 201 - 310
Target Start/End: Complemental strand, 10358486 - 10358377
Alignment:
| Q |
201 |
gatactgaatgaaaaactttgattaggttttatggattgattttgcgctatttgatttggttattgtttgttgtaatcgcattggtgtgttttagggata |
300 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10358486 |
gatactgaataaaaaactttgattaggttttatggattgattttgcgctatttgatttggttattgtttgttgtaatcgcattggtgtgttttagggata |
10358387 |
T |
|
| Q |
301 |
ttttttgaat |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
10358386 |
ttttttgaat |
10358377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 20 - 114
Target Start/End: Complemental strand, 10358667 - 10358573
Alignment:
| Q |
20 |
ttctgagctcggtaatttcatcggtgcgcctgaagtttcgcggactgaagctgttaagaaagtttgggagtatatcaagctgcagaatcttcagg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10358667 |
ttctgagctcggtaatttcatcggtgcgcctgaagtttcgcggactgaagctgttaagaaagtttgggagtatatcaagctgcagaatcttcagg |
10358573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University