View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7803_low_20 (Length: 234)
Name: NF7803_low_20
Description: NF7803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7803_low_20 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 16 - 234
Target Start/End: Original strand, 30073987 - 30074207
Alignment:
| Q |
16 |
tgtgtccttgttactcagtcggctcggaacttgattgcttttgttagaaggctagaagtggatttaatccaaagaaaatgctactatctactaaaatagc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30073987 |
tgtgtccttgttactcagtcggctcggaacttgattgcttttgttagaaggatagtagtggatttcatccaaagaaaatgctactatctactaaaatagc |
30074086 |
T |
|
| Q |
116 |
ttaccaaaatgagcttaagatggtttttatgatgagttttcgtttcctgtaagcttga--nnnnnnnaatgttgagagtcattgattcacacactcatga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30074087 |
ttaccaaaatgagcttaagatggtttttatgatgagttttcgtttcctgtaagcttgatttttttttaatgttgagagtcattgattcacacactcatga |
30074186 |
T |
|
| Q |
214 |
aatgaaagttaaaagaagttt |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30074187 |
aatgaaagttaaaagaagttt |
30074207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University