View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7804_high_10 (Length: 292)
Name: NF7804_high_10
Description: NF7804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7804_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 63 - 280
Target Start/End: Original strand, 6528365 - 6528582
Alignment:
| Q |
63 |
atcatcatcgttatcgagtttgtggagcaattggtgaattggtgttgattcggagagtttgatttcagaggaggaaggtgagaaagtggaagaaaagtct |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6528365 |
atcatcatcgttatcgagtttgtggagcaattggtgaattggtgttgattcggagagtttgatttcagaggaggaaggtgagaaagtggaagaaaagtct |
6528464 |
T |
|
| Q |
163 |
tccctgagagggagacgagtgtaggtggtggcgtcgccggcggagaggagtggcggttccggtgaggacttgtgggtgttgagtttaggatttggaggag |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6528465 |
tccctgagagggagacgagtgtaggtggtggcgtcgccggcggagaggagtggcggttccggtgaggacttgtgggtgttgagtttaggatttggaggag |
6528564 |
T |
|
| Q |
263 |
gtttggatttggcgcggg |
280 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
6528565 |
gtttggatttggtgcggg |
6528582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 91 - 236
Target Start/End: Original strand, 2974107 - 2974252
Alignment:
| Q |
91 |
aattggtgaattggtgttgattcggagagtttgatttcagaggaggaaggtgagaaagtggaagaaaagtcttccctgagagggagacgagtgtaggtgg |
190 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||||| ||||||||||||||||| | ||| || || ||||||||| || ||||||||||||||| |
|
|
| T |
2974107 |
aattggtgaatttgagttgattcagagagtttgattttggaggaggaaggtgagaatggggatgataaatcttccctgtcgggaagacgagtgtaggtga |
2974206 |
T |
|
| Q |
191 |
tggcgtcgccggcggagaggagtggcggttccggtgaggacttgtg |
236 |
Q |
| |
|
||||| | | ||||| |||||| |||||| ||| ||||||||| |
|
|
| T |
2974207 |
tggcgccattgaaggagaagagtggtggttcctgtggggacttgtg |
2974252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University