View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7804_low_13 (Length: 271)
Name: NF7804_low_13
Description: NF7804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7804_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 38892536 - 38892774
Alignment:
| Q |
18 |
atattgtacaggttactttcttcttgctgaaaaatcttattattccttgattcccaagaaacagtaatgctaagtaaaacaaaatattccatcaagaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38892536 |
atattgtacaggttactttcttcttgctgaaaaatcttattattccttgattcccaagaaacagtaatgctaagtaaaacaaaatattccatcaagaatt |
38892635 |
T |
 |
| Q |
118 |
gctcgcaaataattttgattggctgattatcacccctgacccatgtgttttctcgaaacattattcgcgacaaatagcattggtgtctaagaaattcaaa |
217 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38892636 |
gctagcaaataattttgattggctgattatcacccttgacccatgtgttttctcgaaacattattcgcgacaaatagcattggtgtctaagaaattcaaa |
38892735 |
T |
 |
| Q |
218 |
tgcatgcaagccatatgacatggaattttctcgcaacat |
256 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38892736 |
tacatgcaagccatatgacatggaattttctcgcaacat |
38892774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 39972496 - 39972544
Alignment:
| Q |
108 |
atcaagaattgctcgcaaataattttgattggctgattatcacccctga |
156 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39972496 |
atcaagaattgctcgcgaataattttgattggctgattatcacccctga |
39972544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 88 - 155
Target Start/End: Complemental strand, 39972490 - 39972423
Alignment:
| Q |
88 |
taagtaaaacaaaatattccatcaagaattgctcgcaaataattttgattggctgattatcacccctg |
155 |
Q |
| |
|
|||||||| | ||| |||||||||| ||||| | || |||||||||||||| |||||||||||||||| |
|
|
| T |
39972490 |
taagtaaagcgaaacattccatcaaaaattgtttgcgaataattttgattgactgattatcacccctg |
39972423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 80 - 155
Target Start/End: Complemental strand, 22372908 - 22372833
Alignment:
| Q |
80 |
agtaatgctaagtaaaacaaaatattccatcaagaattgctcgcaaataattttgattggctgattatcacccctg |
155 |
Q |
| |
|
|||||||||| ||||| | ||| || ||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
22372908 |
agtaatgctatgtaaagcgaaacatcccatcaagaattgcttgcgaataattttgattggctgattatcacccctg |
22372833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University