View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7805_low_7 (Length: 283)
Name: NF7805_low_7
Description: NF7805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7805_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 41 - 247
Target Start/End: Complemental strand, 49018415 - 49018209
Alignment:
| Q |
41 |
agaagaagcaccaatcacttaagagttgtttgataaatgagcacactccaatattgatgataatggctactgcataatggaaaggtgaaaacaattcaaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49018415 |
agaagaagcaccaatcacttaagagttgtttgataaatgagcacactccaatattgatgataatggctactgcataatggaaaggtgaaaacaactcaaa |
49018316 |
T |
 |
| Q |
141 |
ttgatggagacaacattgtctattcctaggagagcaaacgttaattaacaaaaagcttaacgtgctcaaaatgtcatctatatttgggttggaataataa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49018315 |
ttgatggagacaacattgtctattcctaggagagcaaacgttaattaacaaaaagcttaacgtgctcaaaatgtcatctatatttgggttggaataataa |
49018216 |
T |
 |
| Q |
241 |
taataat |
247 |
Q |
| |
|
||||||| |
|
|
| T |
49018215 |
taataat |
49018209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 48877666 - 48877630
Alignment:
| Q |
1 |
atgttatttttgaattagatgcagaattagtggtcga |
37 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48877666 |
atgttatttttgaattagatgcaaaattagtggtcga |
48877630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University