View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7806_high_12 (Length: 323)
Name: NF7806_high_12
Description: NF7806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7806_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 60 - 309
Target Start/End: Original strand, 52270987 - 52271236
Alignment:
| Q |
60 |
gttatcataatctcaaagcctgattggtgtacattgcataggttttgtcaatttcgtgaaatactaaaattaatagatcttacatggagttcttcctttt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52270987 |
gttatcataatctcaaagcctgattggtgtacattgcataggttttgtcaatttcgtgaaatactaaaattaatagatcttacatggaattcttcctttt |
52271086 |
T |
 |
| Q |
160 |
atcctggtatcaggaacaacatttaatttctttatgagattgaaaactcctctgctgctttcatcttcagccggtgaaaagaattgagcgttcttctcct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52271087 |
atcctggtatcaggaacaacatttaatttctttatgagattgaaaactcccctgctgctttcatcttcagccggtgaaaagaattgagcgttcttctcct |
52271186 |
T |
 |
| Q |
260 |
gttacacattacaattttgatataaaaacaaaaataatcatcatttcatc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52271187 |
gttacacattacaattttgatataaaaacaaaaataatcatcatttcatc |
52271236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 18 - 87
Target Start/End: Original strand, 52270919 - 52270988
Alignment:
| Q |
18 |
caaatatggctgcagcatacaataatggaacaaaccgttagcgttatcataatctcaaagcctgattggt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52270919 |
caaatatggctgcagcatacaataatggaacaaaccgttagcgttatcataatctcaaagcctgattggt |
52270988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University