View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7807_high_13 (Length: 300)
Name: NF7807_high_13
Description: NF7807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7807_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 11361188 - 11361463
Alignment:
| Q |
1 |
agagtttttcataattttgttggggttagaccttaattattaagcttatgagaagctttattttgctatgaaattatttaggtacaaggaggggctacta |
100 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11361188 |
agagtttcacataattttgttgggtttagaccttaattattaagcttctgagaagctttattttgctatgaaattatttaggtgcaaggaggggctacta |
11361287 |
T |
 |
| Q |
101 |
tcatactctttatgattgttt----ttctaaaatgccaatttggctgccttacaggttacttgtttaagagtaaaatgaagtaatgacaaagactgtcaa |
196 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11361288 |
tcatactctttatgattgtttcattttctaaaatgccaatttg-------------ttacttgtttaagagtaaaattaagtaatgacaaagactgtcaa |
11361374 |
T |
 |
| Q |
197 |
aaaagtgggttggatgcaaatatctctctaatatttataagctgataagcattagcaatgctttaatactctttattatgaggtgatgt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11361375 |
aaaagtgggttggatgcaaatatctctctaatatttataagctgataagcattagcaatgctttaatactctttattatgaggtgatgt |
11361463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University