View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7807_high_25 (Length: 229)

Name: NF7807_high_25

Description: NF7807

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF7807_high_25

[»] chr4 (1 HSPs)

[»] chr1 (1 HSPs)

Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)

Name: chr4

Description:

Target: chr4; HSP #1

Raw Score: 135; E-Value: 2e-70

Query Start/End: Original strand, 19 - 215

Target Start/End: Complemental strand, 50005958 - 50005760

Alignment:

Q	19	acatctgtttaagaataaaacaaatcattaacaaaagaatacaacagaaaaattatgaagtttt-cataaaagtt-gataccagccagcagcctccatgg	116	Q
		\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\| \| \|\|\|\|\| \|\|\|\|\|\|\|\| \|\|\|\|\|\|\|
T	50005958	acatctgttcaagaataaaacagatcattaacaaaaaaatacaacaaaaaaattatgaagtttttcataaaagtttggtaccaaccagcagcttccatgg	50005859	T

Q	117	ctttgatgagatctttcttcttcggaactctcttaatatcaatcttgatgtcagtgagtgagagcctcttgaaatttatagggggcctcttcatatcag	215	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\| \|\|\|\|\|\|\|\|
T	50005858	ctttgatgagatccttcttcttcggaactctcttaatatcgatcttgatgtctgtgagtgagagcctcttgaaatttataggggacctctccatatcag	50005760	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)

Name: chr1

Description:

Target: chr1; HSP #1

Raw Score: 49; E-Value: 4e-19

Query Start/End: Original strand, 104 - 192

Target Start/End: Complemental strand, 33548422 - 33548334

Alignment:

Q	104	gcagcctccatggctttgatgagatctttcttcttcggaactctcttaatatcaatcttgatgtcagtgagtgagagcctcttgaaatt	192	Q
		\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\| \|\|\|\|\|\|\|\| \|\|\|\|\| \|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\| \|\| \|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	33548422	gcagcttccatggctttgacgagatccttcttcttaggaaccctcttgatatcaatcttgatatcagttagagaaagcctcttgaaatt	33548334	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]