View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7807_high_25 (Length: 229)

Name: NF7807_high_25
Description: NF7807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7807_high_25
NF7807_high_25
[»] chr4 (1 HSPs)
chr4 (19-215)||(50005760-50005958)
[»] chr1 (1 HSPs)
chr1 (104-192)||(33548334-33548422)


Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 50005958 - 50005760
Alignment:
19 acatctgtttaagaataaaacaaatcattaacaaaagaatacaacagaaaaattatgaagtttt-cataaaagtt-gataccagccagcagcctccatgg 116  Q
    ||||||||| |||||||||||| ||||||||||||| ||||||||| ||||||||||||||||| |||||||||| | ||||| |||||||| |||||||    
50005958 acatctgttcaagaataaaacagatcattaacaaaaaaatacaacaaaaaaattatgaagtttttcataaaagtttggtaccaaccagcagcttccatgg 50005859  T
117 ctttgatgagatctttcttcttcggaactctcttaatatcaatcttgatgtcagtgagtgagagcctcttgaaatttatagggggcctcttcatatcag 215  Q
    ||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||    
50005858 ctttgatgagatccttcttcttcggaactctcttaatatcgatcttgatgtctgtgagtgagagcctcttgaaatttataggggacctctccatatcag 50005760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 33548422 - 33548334
Alignment:
104 gcagcctccatggctttgatgagatctttcttcttcggaactctcttaatatcaatcttgatgtcagtgagtgagagcctcttgaaatt 192  Q
    ||||| ||||||||||||| |||||| |||||||| ||||| ||||| |||||||||||||| ||||| || || ||||||||||||||    
33548422 gcagcttccatggctttgacgagatccttcttcttaggaaccctcttgatatcaatcttgatatcagttagagaaagcctcttgaaatt 33548334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University