View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7807_low_14 (Length: 331)
Name: NF7807_low_14
Description: NF7807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7807_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 37 - 312
Target Start/End: Complemental strand, 41079493 - 41079213
Alignment:
| Q |
37 |
tcgtgttcccaattcatagtattgatagaatagaatgaacaacatacgaaacaacctacctggatgatgtcttcaaactggaaccatctcgacctcatta |
136 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41079493 |
tcgtgttcccaattcatagtatttatagaatagaatgaacaacatacgaaacaacctacctggatgatgtcttcaaactggaaccatctcgacctcatta |
41079394 |
T |
|
| Q |
137 |
cccgt-----gcgccactgtcgccggtgagggcgaacgccaccacttgatgaagatttcgtagcacatccggattgtcaagtagatgaaatctataacca |
231 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41079393 |
cccgtctcaggcgccactgtcgccggtgaggatgaacgccaccacttgatgaagatttcgtagcacatccgaattgtcaagtagatgaaatctataacca |
41079294 |
T |
|
| Q |
232 |
aggcagtgataatggataacataaaaacctggaagattgtgcgaaagttatccgaccaagacgatattgttggatttctgt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41079293 |
aggcagtgataatggataacataaaaacctggaagattgtgcgaaagttatccgaccaagacgacattgttggatttctgt |
41079213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University