View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7807_low_22 (Length: 239)
Name: NF7807_low_22
Description: NF7807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7807_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 225
Target Start/End: Original strand, 20623968 - 20624181
Alignment:
| Q |
13 |
aatataaagtcgctgccactatgagcatgttggctttgatggggtaacgaaacagttggatgaagtcatgaataccttagtatttgttgaaggacctttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20623968 |
aatataaagtcgctgccactatgagcatgttggctttgatggggtaacgaaacagttggatgaagtcatgaataccttagtatttgttgaaggacctttg |
20624067 |
T |
 |
| Q |
113 |
gcactttcgactcttatgctccaatgcttgtagtcatctttaacggtataaggaggcattctcacta-tctcaactttgaagtgaaaaaaggaactatga |
211 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20624068 |
gcactttcgactcttatgctccgatgcttgtagtcatctttaacggtataacgaggcattctcactacactcaactttgaagtgaaaaaaggaactatga |
20624167 |
T |
 |
| Q |
212 |
taggacacataaat |
225 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
20624168 |
tagaacacataaat |
20624181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University