View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7808_low_2 (Length: 471)
Name: NF7808_low_2
Description: NF7808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7808_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 32 - 273
Target Start/End: Complemental strand, 38297850 - 38297599
Alignment:
| Q |
32 |
gagtttggtggtgcagaaggatttgtccagtattcttggtgttcgacttgtcatgcgtgcggagaaatatctaggcctgccttcaacgattgcaagggat |
131 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38297850 |
gagtttggcggtgcagaaggatttgtccagtattcttggtgttcgacttgtcatgggtgcggagaaatatctaggcctgccttcaacgattgcaagggat |
38297751 |
T |
|
| Q |
132 |
aaagtttcaatttttcatttataaaggatcgtatatggaatcgaattaatgctttgtgtggtcatgctttgtctagagtaagtaag--------gattaa |
223 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38297750 |
aaagtttcaatttttcatttattaaggatcgtatatggaatcgaattaatgttttgtgtggtcatgctttgtctagagtaagtaaggaagtaatgattaa |
38297651 |
T |
|
| Q |
224 |
atccgtgctcccgtgag--tatttatgcactacctaactctatcatcgatga |
273 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38297650 |
atccgtgctcccgtgagtatatttatgcactacctaactctatcatcgatga |
38297599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 272 - 421
Target Start/End: Complemental strand, 38297522 - 38297373
Alignment:
| Q |
272 |
gagttgcctgtcctaaggatgtcggtgggatggggtttcgcaattttaaagcctttaatttagccatggtggcaagcaggaatgaaattttctatcaaaa |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38297522 |
gagttgcctgtcctaaggatgtcggtgggacggggtttcgcaattttaaagcctttaatttagccatggtggcaagcagggatgaaattttctatcaaaa |
38297423 |
T |
|
| Q |
372 |
ccagatgcattggtgtcaagaattttcaaagcaaggtatttttctcgcac |
421 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38297422 |
ccaaatgcattggtgtcaagaattttcaaagcaaggtatttttctcgcac |
38297373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University