View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7809_high_5 (Length: 219)

Name: NF7809_high_5
Description: NF7809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7809_high_5
NF7809_high_5
[»] chr8 (1 HSPs)
chr8 (150-201)||(40938762-40938813)


Alignment Details
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 150 - 201
Target Start/End: Original strand, 40938762 - 40938813
Alignment:
150 cggtgaatctctcttttctcttctttattagagaagctttttcgatacgttt 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
40938762 cggtgaatctctcttttctcttctttattagagaagctttttcgatacgttt 40938813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University