View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7809_high_6 (Length: 215)
Name: NF7809_high_6
Description: NF7809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7809_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 14 - 209
Target Start/End: Original strand, 41118103 - 41118298
Alignment:
| Q |
14 |
tttggtgttggaaataaattttaagaaagttaagatttgatcatcatattaacttctctaagatgcaaaccaggtaaaatgtaattttacggaagccttc |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
41118103 |
tttgatgttggaaataaattttaagaaagttaagatttgatcatcatattaacttctctaagatgcaaacctgataaaatgtaattttacggaagccttc |
41118202 |
T |
 |
| Q |
114 |
agccccacattgagtgcagaaaatccctgatgacttgtaaagaccctacaacaaatcaaattcatagtaagtaagcacatcccccgccccctctgt |
209 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41118203 |
agccccacattgagtgcagaaaatcccagatgacttgtaaagaccctacaacaaatcaaattcatagtaagtaagcacatcccccgccccctctgt |
41118298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 22 - 201
Target Start/End: Original strand, 41107645 - 41107822
Alignment:
| Q |
22 |
tggaaataaattttaagaaagttaagatttgatcatcatattaacttctctaagatgcaaaccaggtaaaatgtaattttacggaagccttcagccccac |
121 |
Q |
| |
|
||||||| ||||||||| |||| || | ||||||||||||||||| |||||||||||||||| | |||||||||||||||||||||||||||||| ||| |
|
|
| T |
41107645 |
tggaaattaattttaaggaagtaaa--tctgatcatcatattaactcctctaagatgcaaacctgataaaatgtaattttacggaagccttcagcctcac |
41107742 |
T |
 |
| Q |
122 |
attgagtgcagaaaatccctgatgacttgtaaagaccctacaacaaatcaaattcatagtaagtaagcacatcccccgcc |
201 |
Q |
| |
|
||||||| |||||| |||| ||||||||||||||||||||| | |||||||||| ||| |||||| ||||| ||||||| |
|
|
| T |
41107743 |
attgagtacagaaattcccagatgacttgtaaagaccctacgaaaaatcaaatttatattaagtagacacattccccgcc |
41107822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University