View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7810_high_12 (Length: 229)

Name: NF7810_high_12
Description: NF7810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7810_high_12
NF7810_high_12
[»] chr1 (1 HSPs)
chr1 (31-217)||(45546471-45546657)


Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 31 - 217
Target Start/End: Original strand, 45546471 - 45546657
Alignment:
31 ctactcataacagacttcttctcaggctcaggctcaggctcagtgggctcttctggtccatgtgtcaatgtcactgcatccaaaatagattcaaataaag 130  Q
    |||||||||||||||||||||||||||||||||||||  | |||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||    
45546471 ctactcataacagacttcttctcaggctcaggctcagaattagtgggctcttctggtccatgtgtcagtgtcacttcatccaaaatagattcaaataaag 45546570  T
131 tagnnnnnnntgcttcaaacttaaaaactaccaagtatagtatatattaactcttgcttcaaacaaaatgatatgatacctggatat 217  Q
    |||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45546571 tagaaaaaaatgcttcaaacttaaaaactaccaagtatagtatatattaactcttgcttcaaacaaaatgatatgatacctggatat 45546657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University