View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7810_low_10 (Length: 286)
Name: NF7810_low_10
Description: NF7810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7810_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 1028274 - 1028514
Alignment:
| Q |
11 |
cagagataccaaatacgctcgatgttagcccttggaagcaaaaattcatggtcatctttgttctcatgagttcaacgattacttcatcagtgctggctcg |
110 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1028274 |
cagagataccaaatacgatcgatgttggcccttggaagcaaaagctcatggtcatctttgttctcatgagttcaacgattacttcatcagtgctggctcg |
1028373 |
T |
|
| Q |
111 |
taaatacaaa-gaaaattagtcgacttttgaggcattggtaccaattaggtcaccatcacacttcttaggatgagaccatgagcttctgctatcgacaag |
209 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1028374 |
taaatacaaaagaaaattagttgacttttgaggcattggtaccaattagctcaccatcacacttcttaggatgagaccatgagcttctgctatcgacata |
1028473 |
T |
|
| Q |
210 |
taccaattaggtcaccgtcacactcgttaggatgaggatga |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1028474 |
taccaattaggtcaccgtcacactcgttaggatgaggatga |
1028514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University