View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7810_low_13 (Length: 245)
Name: NF7810_low_13
Description: NF7810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7810_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 52373613 - 52373397
Alignment:
| Q |
18 |
agagatacctgttttctccttttacgattcctttgtcacccgttcgaagaaaacacttacgaactgtgtttctgattcttgcatgaaaaacttctcttgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52373613 |
agagatacctgttttctccttttacgattcctttgtcacccgttcgaagaaaacacttacgaactgtgtttctgattcttgcatgaaaaacttctcttgt |
52373514 |
T |
|
| Q |
118 |
taaagaagggtgaccaaggtaaccagaggcattacttggagatgaaacccaaatttctccttcaacaccatcttcaacagcttcaagtgtttcttcatta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52373513 |
taaagaagggtgaccaaggtaaccagaggcattacttggagatgaaacccaaatttctccttcaacaccatcttcaacagcttcaagtgtttcttcatta |
52373414 |
T |
|
| Q |
218 |
acaaccatgatgtccat |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
52373413 |
acaaccatgatgtccat |
52373397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University