View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7810_low_14 (Length: 229)
Name: NF7810_low_14
Description: NF7810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7810_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 31 - 217
Target Start/End: Original strand, 45546471 - 45546657
Alignment:
| Q |
31 |
ctactcataacagacttcttctcaggctcaggctcaggctcagtgggctcttctggtccatgtgtcaatgtcactgcatccaaaatagattcaaataaag |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
45546471 |
ctactcataacagacttcttctcaggctcaggctcagaattagtgggctcttctggtccatgtgtcagtgtcacttcatccaaaatagattcaaataaag |
45546570 |
T |
 |
| Q |
131 |
tagnnnnnnntgcttcaaacttaaaaactaccaagtatagtatatattaactcttgcttcaaacaaaatgatatgatacctggatat |
217 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45546571 |
tagaaaaaaatgcttcaaacttaaaaactaccaagtatagtatatattaactcttgcttcaaacaaaatgatatgatacctggatat |
45546657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University