View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7810_low_15 (Length: 216)
Name: NF7810_low_15
Description: NF7810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7810_low_15 |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0088 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 33 - 196
Target Start/End: Complemental strand, 46338 - 46175
Alignment:
| Q |
33 |
tacacaccaattctctactctcctcgtacgtagtaaagagaaaactgaactgctttatgaaatactatgttaagcagagggagtaacctcgttatttata |
132 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46338 |
tacacaccaattatctgctctcctcgtatgtagcaaagagaaaactgaactgctttatgaaatactatgttaagcagaggtagtaacctcgttatttata |
46239 |
T |
 |
| Q |
133 |
atcggaggtcacttacatttctaatgtattctaataccatattatttaataaatgattttacat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
46238 |
atcggaggtcacttacatttctaatgtattataataccttattatttaataaatgattttacat |
46175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University