View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7810_low_2 (Length: 501)
Name: NF7810_low_2
Description: NF7810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7810_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 1e-85; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 179 - 407
Target Start/End: Original strand, 956321 - 956550
Alignment:
| Q |
179 |
tgagaaagaaatagggtttgcaatttgtttctatctcttttgatggaatattagtcatcagttactaatattccatgtttctatctcttcataaa-tatt |
277 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| | || |
|
|
| T |
956321 |
tgagaaggaactagggtttgcaatttgtttctatctcttttgatggaatattattcatcacttactaatattccatgtttctatctcttcataaactctt |
956420 |
T |
 |
| Q |
278 |
gatatgtggaggaannnnnnnagtttatgcctctatatgaatggctttataaacggaacaccacttttaataaaagtttccattacaatatttgaacctt |
377 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
956421 |
gatatgtggaggaatttttttagtttatgcctctatatgaatggctttacaaacggaacactacctttaataaaagtttccattgcaatatttgaacctt |
956520 |
T |
 |
| Q |
378 |
cattgttgttcatgctagcttcaggtcatg |
407 |
Q |
| |
|
||||||||||||||||||||| |||||||| |
|
|
| T |
956521 |
cattgttgttcatgctagctttaggtcatg |
956550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 17 - 52
Target Start/End: Original strand, 953421 - 953456
Alignment:
| Q |
17 |
agtttgttacaaaacccacgggcctctcttgaatgg |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
953421 |
agtttgttacaaaacccacgggcctctcttgaatgg |
953456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University