View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7811_high_29 (Length: 353)
Name: NF7811_high_29
Description: NF7811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7811_high_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 18 - 345
Target Start/End: Original strand, 43003570 - 43003897
Alignment:
| Q |
18 |
caagctgcctcaagacatgtctcaagcacggtggttgttgagtcgtcgttatggactcttgcttaaagttcctgaacaaaagaagggtctctgaggagaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003570 |
caagctgcctcaagacatgtctcaagcacggtggttgttgagtcgtcgttacggactcttgcttgaagttcctgaacaaaagaagggtctctgaggagaa |
43003669 |
T |
|
| Q |
118 |
cttcgtcggcagtgattatggcttggatgtgttccacgttgatgatgatggctctttctcgtccgggaacaatggaataagcacaaggggaggaaaagat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003670 |
cttcgtcggcagtgattatggcttggatgtgttccacgttgatgatgatggctctttctcgtccgggaacaatggaataagcacaaggggaggaaaagat |
43003769 |
T |
|
| Q |
218 |
agggtctaggattcttctaaggtcacgtaaggtgaggccagtacgcctcatgatgtcaagcgctccggccttaaacacatgcgcatctccagtactgtcg |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43003770 |
agggtctaggattcttctaaggtcacgtaaggtgaggccagtacgcctcatgatgtcaagcgctccggccttaaacacatgtgcatctccagtactgtcg |
43003869 |
T |
|
| Q |
318 |
accaacagccatggctgaacttcttctc |
345 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
43003870 |
accaacagccatggctgaacttcatctc |
43003897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University