View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7811_high_47 (Length: 254)
Name: NF7811_high_47
Description: NF7811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7811_high_47 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 30023240 - 30023004
Alignment:
| Q |
1 |
tttcttcctcgcttaaatcaaattctcgtaactttctaacttttaagggactaaaattgtatttttgtattttgtgaggactaattaaatatgaattttc |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30023240 |
tttcttcctcacttaaatcaaattctcataactttctaacttttaagggactaaaattgtatttttgtattttgtgaggactaattaaatatgaattttc |
30023141 |
T |
 |
| Q |
101 |
ataatatatacccctcaataatagcttttgctttcagacagatcc-nnnnnnnncgtcactatcccttcaccaaaaccagcaaacaagtaaggaattata |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30023140 |
ataatatatacacctcaataatagcttttgctttcagacagatccaaaaaaaaacgtcactatcccttcaccaaaaccagcaaacaagtaaggaattata |
30023041 |
T |
 |
| Q |
200 |
ccaacaaattcaaatgactatgtataacaacaaatac |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30023040 |
ccaacaaattcaaatgactatgtataacaacaaatac |
30023004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University