View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7811_low_41 (Length: 300)
Name: NF7811_low_41
Description: NF7811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7811_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 38 - 284
Target Start/End: Original strand, 33734885 - 33735132
Alignment:
| Q |
38 |
ataactaatgcttatatctatgcagattttgaatgatgtcgcgatggacttcatcacaaggttacaccatcattttggtggtaattgatc-catttctaa |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33734885 |
ataactaatgcttatatctatgcagattttggatgatgtcgcgatggacttcatcacaaggttacaccatcattttggtggtaattgatcgcatttctaa |
33734984 |
T |
|
| Q |
137 |
gtacactcacatcgctgcattaaaatcatagtacacgagctctaaggatgttgaaaccttcatgcacattctggtgaagttgcatggtatttcaaataat |
236 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33734985 |
gtacactcgcatcgctgcattaaaatcatagtacacgagctctaaggatgttgaaaccttcatacacattctggtgaagttgcatggtatttcaaataat |
33735084 |
T |
|
| Q |
237 |
attgttttcgacaaggatcgggggtctttgctattcgtttctctcaaa |
284 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33735085 |
attgttttcgataaggatcgggggtctttaatattcgtttctctcaaa |
33735132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University