View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7811_low_45 (Length: 270)
Name: NF7811_low_45
Description: NF7811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7811_low_45 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 974928 - 974674
Alignment:
| Q |
1 |
acaagtattaactatcattaattttgtctcatctttaaaaatagctagatgcgtgacgtttagtttgagtggccgacccctaacatgattgatccttatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
974928 |
acaagtattaactatcattaattttgtctcatctttaaaaatagctagatgcgtgacgtttagtttgagtggccgacccctaacatgattgatccttatc |
974829 |
T |
|
| Q |
101 |
catcacatgctattttccctttaaatttggnnnnnnntagaaaaagttttttgcacacaaaacatgtgattgaattgagtgtggaatggcaaatggtgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
974828 |
catcacatgctattttccctttaaatttggaaaaaaatagaaaaagttttttgcacacaaaacatgtgattgaattgagtgtggaatggcaaatggtgta |
974729 |
T |
|
| Q |
201 |
agaaagaaactctttttcttgtgaagatacgaagaaataggcatgcagttaaaaa |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
974728 |
agaaagaaactctttttcttgtgaagatacgaagaaataggcatgcagttaaaaa |
974674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University