View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7811_low_48 (Length: 256)
Name: NF7811_low_48
Description: NF7811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7811_low_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 4 - 209
Target Start/End: Complemental strand, 30023492 - 30023287
Alignment:
| Q |
4 |
atgacactttagaaattcaatcaaatttttgacccaaccgatgtttttggactttcaaaggtgttatgtcacataccaaatgtactttaataccaaaatt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30023492 |
atgacactttagaaattcaatcaaatttttgacccaaccgatgtttttggactttcaaaggtgttatgtcacataccaaatgtactgtaataccaaaatt |
30023393 |
T |
 |
| Q |
104 |
tggtacatttagatgcaatggttatattttggagacaatttaaatctctaattttttaaaagccttaaatcagaagatcatcctcttctcgctattaagt |
203 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30023392 |
tggtaaatttagatgcaatggttatattttggagacaatttaaatctctaattttttaaaagccttaaatcagaagatcatcctcttctcgctcttaagt |
30023293 |
T |
 |
| Q |
204 |
tcaaat |
209 |
Q |
| |
|
|||||| |
|
|
| T |
30023292 |
tcaaat |
30023287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University