View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7811_low_49 (Length: 256)
Name: NF7811_low_49
Description: NF7811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7811_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 29446587 - 29446818
Alignment:
| Q |
16 |
aagctcactatgattccaaccatgcacttagttctccgtaggaagagaagctttggctataggttggtaaaccggcaagtcacaaaaaggcgatggaccg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29446587 |
aagctcactatgattccaaccatgcacttagttctccgtaggaagagaagctttggctataggttggtaaaccggcaagtcacaaaaaggcgatggaccg |
29446686 |
T |
|
| Q |
116 |
cattagaggtccttatggctatatatatgtatgt-tgtatgattctggtgtgattcttctttgagtagaatatatattgtaatagacaaagatgttgttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29446687 |
cattagaggtccttatggctatatatctgtatgtgtgtatgattctggtgtgattcttctttgaagagaatatatattgtaatagacaaagatgttgttc |
29446786 |
T |
|
| Q |
215 |
ctttgagaagctaccaacttgtgatgtttcat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29446787 |
ctttgagaagctaccaacttgtgatgtttcat |
29446818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University