View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7811_low_51 (Length: 253)
Name: NF7811_low_51
Description: NF7811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7811_low_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 1971587 - 1971422
Alignment:
| Q |
1 |
aggcgaaagaaggaagcgcgccgataactttgagaattgccggaatttaaatggttccggagccgattatgctgggggcgacattgaatacggcgtcgat |
100 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1971587 |
aggcgaaagaaggaagcacgccgagaactttgagaatcgccggaatttaaatgattccggagccgattatgctgggggcgacattgaatacggcgtcgat |
1971488 |
T |
|
| Q |
101 |
cagagacggttgcagcggagacaaaacaaccaaaattgatgccgccatggatgatggtgttgatac |
166 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1971487 |
cagagacggttgcagcggagacaaaacgaccaaaattgatgccgccatggatgatggtggtgatac |
1971422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 32394955 - 32394862
Alignment:
| Q |
1 |
aggcgaaagaaggaagcgcgccgataactttgagaattgccggaatttaaatggttccggagccgattatgctgggggcgacattgaatacggc |
94 |
Q |
| |
|
||||||| ||||||||| | |||| |||||||||||| ||||||||| | ||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
32394955 |
aggcgaaggaaggaagcacaccgagaactttgagaatcgccggaattgacatgattccggagccaattatgctggtggcgacattgaatacggc |
32394862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 91 - 166
Target Start/End: Complemental strand, 19962509 - 19962434
Alignment:
| Q |
91 |
cggcgtcgatcagagacggttgcagcggagacaaaacaaccaaaattgatgccgccatggatgatggtgttgatac |
166 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
19962509 |
cggcgtcgatcagagacggttgcagtagagacaaaacgaccaaagttggtgccgccatggatgatggtggtgatac |
19962434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University