View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7811_low_58 (Length: 245)
Name: NF7811_low_58
Description: NF7811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7811_low_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 37596988 - 37597212
Alignment:
| Q |
1 |
tagtccctaaatttgcttatcctatttatgaacaaccaaattgatgtctaaaatcttctaagcatagtaacatgggcttaattaattttgtgacaaggta |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
37596988 |
tagtccctaaatttgcttatcttatttatgaacaaccaaattgatgtctaaaatcttctaagcatacagacatgggcttaa----ttttgtgacaaggta |
37597083 |
T |
|
| Q |
101 |
taatcagatcagataatatcaagcattaaaatttcatctcatttgccaaacagtttctcgagctttagtgcatagtttgaaatcataggt---ataacga |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37597084 |
taatcagatcagataatatcaagcattaaaatttcatctcatttgccaaacagtttctcgagctttagtgcatagtttgaaatcataggtttaataacga |
37597183 |
T |
|
| Q |
198 |
aattaagatgacatcatgattttgttgaa |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37597184 |
aattaagatgacatcatgattttgttgaa |
37597212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University