View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7811_low_59 (Length: 242)
Name: NF7811_low_59
Description: NF7811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7811_low_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 221
Target Start/End: Complemental strand, 3768578 - 3768373
Alignment:
| Q |
16 |
ataaagtatgtgattgttatttatggtgcatataggcgttgatgcttgatggaaagatgcagagttctgaagcagatgaattcatttatcatgaatgctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3768578 |
ataaagtatgtgattgttatttatggtgcatataggcgttgatgcttgatggaaagatgcagagttctgaagcagatgaattcatttatcatgaatgctt |
3768479 |
T |
|
| Q |
116 |
gattcatccctctcttttatgtcatccaaagtaagtttgttttaatatattaggggaggatgttatagttctttctttgtctttactaataaaaatgaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3768478 |
gattcatccctctcttttatgtcattcaaagtaagtttgttttaatatattaggggaggatgttatagttctttctttgtctttactaataaaaatgaaa |
3768379 |
T |
|
| Q |
216 |
tattag |
221 |
Q |
| |
|
|||||| |
|
|
| T |
3768378 |
tattag |
3768373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 61 - 149
Target Start/End: Complemental strand, 48390131 - 48390043
Alignment:
| Q |
61 |
ttgatggaaagatgcagagttctgaagcagatgaattcatttatcatgaatgcttgattcatccctctcttttatgtcatccaaagtaa |
149 |
Q |
| |
|
||||||||||||||| |||| ||||| || ||||||||||||||||||||||||||||||||| |||| |||||||| || |||||| |
|
|
| T |
48390131 |
ttgatggaaagatgccgagtgctgaaatggacgaattcatttatcatgaatgcttgattcatccccctctattatgtcaccccaagtaa |
48390043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University