View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7811_low_62 (Length: 232)
Name: NF7811_low_62
Description: NF7811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7811_low_62 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 216
Target Start/End: Complemental strand, 33492215 - 33492011
Alignment:
| Q |
11 |
agttccggcttcggttgacagtaattctccgttattaaaggtttgagagagccttgatgaaacccaactgacataccaaaatgacatcatacgacaaaat |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33492215 |
agttccggcttcagttgacagtaattctccattattaaaggtttgagagagccttgatgaaacccaactgacataccaaaatgacatcata-gacaaaat |
33492117 |
T |
 |
| Q |
111 |
gaatacatggtatcttgctgacataccagtttctgattcatgtcatactagtttctaatttttaacctatctcagtttttgcttcatgtcaaaatgacat |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33492116 |
gaatacatggtatcttgctaacataccagtttctgattcatgtcatactagtttctaatttttaacctatctcagtttctgcttcatgtcaaaatgacat |
33492017 |
T |
 |
| Q |
211 |
catatt |
216 |
Q |
| |
|
|||||| |
|
|
| T |
33492016 |
catatt |
33492011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 151
Target Start/End: Original strand, 28811302 - 28811349
Alignment:
| Q |
104 |
acaaaatgaatacatggtatcttgctgacataccagtttctgattcat |
151 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
28811302 |
acaaaatgaatacatggaaccttgctgacataccagtttctgcttcat |
28811349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 45
Target Start/End: Original strand, 28809478 - 28809513
Alignment:
| Q |
10 |
gagttccggcttcggttgacagtaattctccgttat |
45 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28809478 |
gagttccggcttcggttgacagtaatcctccgttat |
28809513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University